/* * The MIT License (MIT) * * Copyright (c) 2007-2015 Broad Institute * * Permission is hereby granted, free of charge, to any person obtaining a copy * of this software and associated documentation files (the "Software"), to deal * in the Software without restriction, including without limitation the rights * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell * copies of the Software, and to permit persons to whom the Software is * furnished to do so, subject to the following conditions: * * The above copyright notice and this permission notice shall be included in * all copies or substantial portions of the Software. * * * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN * THE SOFTWARE. */ package org.broad.igv.tools.motiffinder; import org.broad.igv.batch.CommandExecutor; import org.broad.igv.feature.Locus; import org.broad.igv.track.FeatureTrack; import org.broad.igv.track.Track; import org.broad.igv.ui.AbstractHeadedTest; import org.broad.igv.ui.IGV; import org.broad.igv.ui.IGVMenuBar; import org.broad.igv.ui.panel.FrameManager; import org.broad.igv.ui.panel.ReferenceFrame; import org.broad.igv.util.TestUtils; import htsjdk.tribble.Feature; import org.junit.Test; import javax.swing.*; import java.awt.*; import java.util.ArrayList; import java.util.List; import static junit.framework.Assert.assertEquals; import static junit.framework.Assert.assertTrue; /** * @author jacob * @date 2013-Oct-09 */ public class MotifFinderPluginHeadedTest extends AbstractHeadedTest { private static final String EGFR_begseq ="GCCCCCCGCACGGTGTGAGCGCCCGACGCGGCCGAGGCGGCCGGAGTCCCGAG"; @Test public void testBasicSearch() throws Exception{ List<Track> tracks = MotifFinderPlugin.addTracksForPatterns(new String[]{EGFR_begseq}, new String[]{"pos"}, new String[]{"neg"}); tstSearchEGFR(tracks); } @Test public void testBatchCommand_Error() throws Exception{ CommandExecutor cmdexec = new CommandExecutor(); String cmd = "org.broad.igv.tools.motiffinder.MotifFinderPlugin blarg " + EGFR_begseq; String resp = cmdexec.execute(cmd); assertTrue("Expected ERROR, was " + resp, resp.contains("ERROR")); assertEquals(2, IGV.getInstance().getVisibleTrackCount()); } @Test public void testBatchCommand() throws Exception{ CommandExecutor cmdexec = new CommandExecutor(); String cmd = "org.broad.igv.tools.motiffinder.MotifFinderPlugin find " + EGFR_begseq; String resp = cmdexec.execute(cmd); assertTrue("Expected OK, was " + resp, resp.contains("OK")); List<Track> finderTracks = new ArrayList<Track>(2); //Slight weakness here, we require that the tracks be in order positive/negative, //but don't check that String seqStub = EGFR_begseq.substring(0, 20); for(FeatureTrack ft: IGV.getInstance().getFeatureTracks()){ if(ft.getName().contains(seqStub)){ finderTracks.add(ft); } } tstSearchEGFR(finderTracks); } /** * Test searching EGFR. * @param PosNegFeatureTracks length-2 list of tracks, positive and negative strand motif finders */ private void tstSearchEGFR(List<Track> PosNegFeatureTracks){ assertEquals(2, PosNegFeatureTracks.size()); IGV.getInstance().goToLocus("EGFR"); FeatureTrack posTrack = (FeatureTrack) PosNegFeatureTracks.get(0); FeatureTrack negTrack = (FeatureTrack) PosNegFeatureTracks.get(1); Feature expFeature = new Locus("chr7", 55054248, 55054301); ReferenceFrame frame = FrameManager.getDefaultFrame(); List<Feature> posFeats = posTrack.getFeatures(frame.getChrName(), (int) frame.getOrigin(), (int) frame.getEnd()); assertEquals(1, posFeats.size()); TestUtils.assertFeaturesEqual(expFeature, posFeats.get(0)); List<Feature> negFeats = negTrack.getFeatures(frame.getChrName(), (int) frame.getOrigin(), (int) frame.getEnd()); assertEquals(0, negFeats.size()); } @Test public void testToolsMenuEntryExists() throws Exception{ IGVMenuBar bar = IGVMenuBar.getInstance(); boolean foundFinder = false; for(Component c: bar.getComponents()){ String name = c.getName(); if("Tools".equals(name)){ JMenu menu = (JMenu) c; for(Component toolItem: menu.getMenuComponents()){ if(!(toolItem instanceof JMenuItem)){ continue; } String toolName = ((JMenuItem) toolItem).getText(); if(toolName == null) continue; toolName = toolName.toLowerCase(); if(toolName.contains("motif")){ foundFinder = true; } } } } assertTrue("Find Motif tool entry not found", foundFinder); } }