/*
 *                  Eoulsan development code
 *
 * This code may be freely distributed and modified under the
 * terms of the GNU Lesser General Public License version 2.1 or
 * later and CeCILL-C. This should be distributed with the code.
 * If you do not have a copy, see:
 *
 *      http://www.gnu.org/licenses/lgpl-2.1.txt
 *      http://www.cecill.info/licences/Licence_CeCILL-C_V1-en.txt
 *
 * Copyright for this code is held jointly by the Genomic platform
 * of the Institut de Biologie de l'École normale supérieure and
 * the individual authors. These should be listed in @author doc
 * comments.
 *
 * For more information on the Eoulsan project and its aims,
 * or to join the Eoulsan Google group, visit the home page
 * at:
 *
 *      http://outils.genomique.biologie.ens.fr/eoulsan
 *
 */

package fr.ens.biologie.genomique.eoulsan.bio.readsfilters;

import static org.junit.Assert.assertFalse;
import static org.junit.Assert.assertTrue;

import org.junit.Test;

import fr.ens.biologie.genomique.eoulsan.EoulsanException;
import fr.ens.biologie.genomique.eoulsan.bio.ReadSequence;
import fr.ens.biologie.genomique.eoulsan.bio.readsfilters.IlluminaFilterFlagReadFilter;
import fr.ens.biologie.genomique.eoulsan.bio.readsfilters.ReadFilter;

public class IlluminaFilterFlagReadFilterTest {

  @Test
  public void testAcceptReadSequence() throws EoulsanException {

    ReadFilter filter = new IlluminaFilterFlagReadFilter();
    filter.init();

    // Null case
    assertFalse(filter.accept(null));

    // Not illumina id case
    ReadSequence read = new ReadSequence(0, "read1", "ATG", "wxy");
    assertTrue(filter.accept(read));

    // Good id
    read =
        new ReadSequence(0, "AEGIR:25:B0866ABXX:8:1101:1193:2125 1:N:0:CGATGT",
            "CCGAAGCAGAAGTCTAGAGGCGGGGACTGAAGCAGAAGACAGGAGAAGTGT",
            "@?@DDDD?CBFFDEHCF<FHGGHFB##########################");

    assertTrue(filter.accept(read));

    // Bad id
    read =
        new ReadSequence(0, "AEGIR:25:B0866ABXX:8:1101:1176:2126 1:Y:0:CGATGT",
            "TGGAGNCAGGAGTCTGGGGGGGGGGGGGGTGGTGCAAAACTGGGGGGACGC",
            "###################################################");
    assertFalse(filter.accept(read));

    // Read without the filter flag
    read = new ReadSequence(0,
        "SRR1577083.1 HWI-ST1160:266:D0H3RACXX:6:1315:4634:59858 length=50",
        "TGGAGNCAGGAGTCTGGGGGGGGGGGGGGTGGTGCAAAACTGGGGGGACGC",
        "###################################################");
    assertTrue(filter.accept(read));

  }

}