/*************************************************************************
* *
* This file is part of the 20n/act project. *
* 20n/act enables DNA prediction for synthetic biology/bioengineering. *
* Copyright (C) 2017 20n Labs, Inc. *
* *
* Please direct all queries to act@20n.com. *
* *
* This program is free software: you can redistribute it and/or modify *
* it under the terms of the GNU General Public License as published by *
* the Free Software Foundation, either version 3 of the License, or *
* (at your option) any later version. *
* *
* This program is distributed in the hope that it will be useful, *
* but WITHOUT ANY WARRANTY; without even the implied warranty of *
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the *
* GNU General Public License for more details. *
* *
* You should have received a copy of the GNU General Public License *
* along with this program. If not, see <http://www.gnu.org/licenses/>. *
* *
*************************************************************************/
package act.installer.sequence;
import java.util.List;
import java.util.ArrayList;
import java.util.Set;
import java.util.HashSet;
import java.util.HashMap;
import com.mongodb.DBObject;
import org.json.JSONObject;
import org.json.JSONArray;
import org.json.JSONException;
import org.json.XML;
import act.shared.helpers.MongoDBToJSON;
import act.shared.helpers.P;
import act.shared.sar.SAR;
public class GenBankEntry extends SequenceEntry {
JSONObject data;
JSONObject desc;
public static Set<P<JSONObject, JSONObject>> get_seq_entry_objs(JSONObject root) {
// differentiates between multiple entries (CASE 1) and single entry (CASE 2)
//
// CASE 1:
// {"Bioseq-set": {"Bioseq-set_seq-set": {"Seq-entry": {"Seq-entry_set": {"Bioseq-set": {
// "Bioseq-set_annot": {...}
// "Bioseq-set_seq-set": {"Seq-entry": [
// {"Seq-entry_seq": {"Bioseq": {
// CASE 2:
// {"Bioseq-set": {"Bioseq-set_seq-set": {"Seq-entry": {"Seq-entry_seq": {"Bioseq": {
// The way we do that is to:
// a. traverse Bioseq-set -> Bioseq-set_seq-set -> Seq-entry
// b. check if we encounter a Seq-entry_set (multiple) or Seq-entry_seq (single)
// c. If multip:
// c.A traverse Seq-entry_set -> Bioseq-set
// c.B get Seq-entry array within Bioseq-set_seq-set
// c.C iterate array and traverse Seq-entry_seq -> Bioseq within each
// d. If single: traverse Seq-entry_seq -> Bioseq within it
Set<P<JSONObject, JSONObject>> all = new HashSet<P<JSONObject, JSONObject>>();
// a. traverse Bioseq-set -> Bioseq-set_seq-set -> Seq-entry
String[] init_path = new String[] { "Bioseq-set", "Bioseq-set_seq-set", "Seq-entry" };
JSONObject inside = traverse(root, init_path);
// b. check if we encounter a Seq-entry_set (multiple) or Seq-entry_seq (single)
if (inside.has("Seq-entry_set")) { // multiple entries
System.out.println("###### Received multiple entries");
// c.A traverse Seq-entry_set -> Bioseq-set
String[] m_path = new String[] { "Seq-entry_set", "Bioseq-set"};
JSONObject main = traverse(inside, m_path);
String[] desc_path = new String[] { "Bioseq-set_descr", "Seq-descr" };
JSONObject desc = traverse(main, desc_path);
// c.B get Seq-entry array within Bioseq-set_seq-set
JSONArray entries = main.getJSONObject("Bioseq-set_seq-set").getJSONArray("Seq-entry");
// c.C iterate array and traverse Seq-entry_seq -> Bioseq within each
String[] inside_path = new String[] { "Seq-entry_seq", "Bioseq" };
for (int i=0; i<entries.length(); i++) {
JSONObject entry = traverse(entries.getJSONObject(i), inside_path);
all.add(new P<JSONObject, JSONObject>(entry, desc));
}
} else { // single entry
// d. If single: traverse Seq-entry_seq -> Bioseq within it
String[] inside_path = new String[] { "Seq-entry_seq", "Bioseq" };
JSONObject entry = traverse(inside, inside_path);
String[] desc_path = new String[] { "Bioseq_descr", "Seq-descr" };
JSONObject desc = traverse(entry, desc_path);
all.add(new P<JSONObject, JSONObject>(entry, desc));
}
return all;
}
public static Set<SequenceEntry> parsePossiblyMany(String xml) {
// This file is written to handle rettype=native calls. (Output has Bioseq_ etc.)
// The alternative call of using rettype=fasta returns compact seq data
// but is formatted differently (with TSeq_ etc.)
// See examples at the end of this file.
Set<SequenceEntry> all_entries = new HashSet<SequenceEntry>();
JSONObject jo = null;
try {
jo = XML.toJSONObject(xml);
Set<P<JSONObject, JSONObject>> seq_entries = get_seq_entry_objs(jo);
for (P<JSONObject, JSONObject> gene_entry : seq_entries) {
try {
GenBankEntry entry = new GenBankEntry(gene_entry.fst(), gene_entry.snd());
all_entries.add(entry);
} catch (JSONException e) {
System.out.println("Data: " + gene_entry.fst().toString(4));
System.out.println("Desc: " + gene_entry.snd().toString(4));
System.out.println("Failed to extract some field in Genbank. Err: " + e);
}
}
} catch (JSONException e) {
System.out.println("Failed to parse GenBank XML. Err: " + e);
}
return all_entries;
}
private GenBankEntry(JSONObject gene_entry, JSONObject desc_entry) {
this.data = gene_entry;
this.desc = desc_entry;
this.accessions = extract_accessions();
this.refs = extract_pmids();
this.org_id = extract_org_id();
this.sequence = extract_seq();
this.ec = extract_ec();
// inits this.catalyzed_{rxns, substrates, products}
// optionally; if there are some that we NLP out of the
// "catalysis activity" field read from this entry
extract_catalyzed_reactions();
// new Seq(..) looks at the metadata in this.data for SwissProt fields:
// this.data { "name" : gene_name_eg_Adh1 }
// this.data { "proteinExistence": { "type" : "evidence at transcript level" });
// this.data { "comment": [ { "type": "catalytic activity", "text": uniprot_activity_annotation } ] }
// this.data { "accession" : ["Q23412", "P87D78"] }
// we manually add these fields so that we have consistent data
JSONArray accs = new JSONArray();
for (String a : this.accessions)
accs.put(a);
JSONObject evidence = new JSONObject(), activity = new JSONObject();
String name = "";
this.data.put("name", name);
this.data.put("proteinExistence", evidence);
this.data.put("comment", new JSONArray(new JSONObject[] { activity }));
this.data.put("accession", accs);
// extract_metadata processes this.data, so do that only after updating
// this.data with the proxy fields from above.
this.metadata = extract_metadata();
}
DBObject metadata;
Set<String> accessions;
List<JSONObject> refs;
String sequence;
Long org_id;
String ec;
Set<Long> catalyzed_rxns;
Set<Long> catalyzed_substrates_diverse, catalyzed_substrates_uniform;
Set<Long> catalyzed_products_diverse, catalyzed_products_uniform;
HashMap<Long, Set<Long>> catalyzed_rxns_to_substrates, catalyzed_rxns_to_products;
SAR sar;
DBObject getMetadata() { return this.metadata; }
Set<String> getAccessions() { return this.accessions; }
List<JSONObject> getRefs() { return this.refs; }
Long getOrgId() { return this.org_id; }
String getSeq() { return this.sequence; }
String getEc() { return this.ec; }
Set<Long> getCatalyzedRxns() { return this.catalyzed_rxns; }
Set<Long> getCatalyzedSubstratesUniform() { return this.catalyzed_substrates_uniform; }
Set<Long> getCatalyzedSubstratesDiverse() { return this.catalyzed_substrates_diverse; }
Set<Long> getCatalyzedProductsUniform() { return this.catalyzed_products_uniform; }
Set<Long> getCatalyzedProductsDiverse() { return this.catalyzed_products_diverse; }
HashMap<Long, Set<Long>> getCatalyzedRxnsToSubstrates() { return this.catalyzed_rxns_to_substrates; }
HashMap<Long, Set<Long>> getCatalyzedRxnsToProducts() { return this.catalyzed_rxns_to_products; }
SAR getSar() { return this.sar; }
private DBObject extract_metadata() {
// cannot directly return this.data coz in Seq.java
// we expect certain specific JSON format fields
return MongoDBToJSON.conv(this.data);
}
private Set<String> extract_accessions() {
Set<String> accessions = new HashSet<String>();
// "Bioseq_id": {"Seq-id": [
// {"Seq-id_ddbj": {"Textseq-id": {
// "Textseq-id_version": 1,
// "Textseq-id_accession": "E07950"
accessions.addAll(extract_accessions_under("Seq-id_ddbj"));
accessions.addAll(extract_accessions_under("Seq-id_embl"));
accessions.addAll(extract_accessions_under("Seq-id_genbank"));
accessions.addAll(extract_accessions_under("Seq-id_swissprot"));
accessions.addAll(extract_accessions_under("Seq-id_other"));
if (accessions.size() == 0) {
System.out.println("Got 0 accessions from: " + this.data.toString(2));
System.console().readLine();
}
return accessions;
}
Set<String> extract_accessions_under(String key) {
Set<String> accessions = new HashSet<String>();
String[] initpath = new String[] {"Bioseq_id"};
Set<JSONObject> os = get_inarray(this.data, key, initpath, "Seq-id");
for (JSONObject o : os)
accessions.add(o.getJSONObject(key).getJSONObject("Textseq-id").getString("Textseq-id_accession"));
return accessions;
}
private Set<JSONObject> get_desc_obj(String haskey) {
// the description object is a wierd beast: need it for get_org_id + get_pmids
// 1. We have to traverse down to this.data -> "Bioseq_descr" -> "Seq-descr" -> "Seqdesc" : JSONArray
// 2. Then within this array there are objects like below:
// {"Seqdesc_title": "gDNA encoding NAD synthetase."},
// {"Seqdesc_comment": "OS Bacillus ste ...
// {"Seqdesc_genbank": {"GB-block": { ...
// {"Seqdesc_pub": {"Pubdesc": {"Pubdesc_pub": {"Pub-equiv": {"Pub": {"Pub_patent ...
// {"Seqdesc_source": {"BioSource": {"BioSource_org": {"Org-ref": { ...
// {"Seqdesc_update-date": {"Date": ...
// {"Seqdesc_create-date": {"Date":
//
// For get_org_id and get_pmids we have to retrieve the objects that have fields
// Seqdesc_source and Seqdesc_pub, respectively. We first get the array and then search
// each object within it for one that has the @param field
return get_inarray(this.desc, haskey, new String[] {}, "Seqdesc");
}
private Set<JSONObject> get_inarray(JSONObject in_obj, String has_key, String[] initpath, String pathend) {
Set<JSONObject> objs_having_key = new HashSet<JSONObject>();
JSONObject container = traverse(in_obj, initpath);
Object x = container.get(pathend);
if (x instanceof JSONArray) {
JSONArray desc_array = (JSONArray)x;
for (int i=0; i<desc_array.length(); i++) {
JSONObject o = desc_array.getJSONObject(i);
if (o.has(has_key))
objs_having_key.add(o);
}
} else if (x instanceof JSONObject) {
JSONObject o = (JSONObject)x;
if (o.has(has_key))
objs_having_key.add(o);
}
return objs_having_key;
}
void extract_catalyzed_reactions() {
// optionally add reactions to actfamilies by processing
// "catalytic activity" annotations and then return those
// catalyzed reaction ids (Long _id of actfamilies). This
// function SHOULD NOT infer which actfamilies refer to
// this object, as that is done in map_seq install.
this.catalyzed_rxns = new HashSet<Long>();
this.catalyzed_substrates_uniform = new HashSet<Long>();
this.catalyzed_substrates_diverse = new HashSet<Long>();
this.catalyzed_products_diverse = new HashSet<Long>();
this.catalyzed_products_uniform = new HashSet<Long>();
this.catalyzed_rxns_to_substrates = new HashMap<Long, Set<Long>>();
this.catalyzed_rxns_to_products = new HashMap<Long, Set<Long>>();
this.sar = new SAR();
}
private List<JSONObject> extract_pmids() {
// See comments in get_desc_obj for how we traverse to an array
// and then find an object within with a particular field
List<String> pmids = new ArrayList<String>();
// the pub's contain patents (and probably paper references)
// For patents it looks like:
// {"Seqdesc_pub": {"Pubdesc": {"Pubdesc_pub": {"Pub-equiv": {"Pub": {"Pub_patent": {"Cit-pat": { ...
// For publications it looks like:
// {"Seqdesc_pub": {"Pubdesc": {"Pubdesc_pub": {"Pub-equiv": {"Pub": [
// {"Pub_article": {"Cit-art": {...
// {"Pub_pmid": {"PubMedId": 15057458}}
Set<JSONObject> sourceflds = get_desc_obj("Seqdesc_pub") ;
for (JSONObject sourcefld : sourceflds) {
String[] toPub_path = new String[] { "Seqdesc_pub", "Pubdesc", "Pubdesc_pub", "Pub-equiv" };
Set<JSONObject> o = get_inarray(sourcefld, "Pub_pmid", toPub_path, "Pub");
for (JSONObject pmid_obj : o)
pmids.add(pmid_obj.getJSONObject("Pub_pmid").getInt("PubMedId") + "");
}
List<JSONObject> pmidReferences = new ArrayList<>();
for (String pmid : pmids) {
JSONObject obj = new JSONObject();
obj.put("val", pmid);
obj.put("src", "PMID");
pmidReferences.add(obj);
}
return pmidReferences;
}
private Long extract_org_id() {
// See comments in get_desc_obj for how we traverse to an array
// and then find an object within with a particular field
Long org_id = null;
Set<JSONObject> sourceflds = get_desc_obj("Seqdesc_source") ;
if (sourceflds.size() > 1)
System.out.println("WARN: Genbank entry has more than one source organism id.");
for (JSONObject sourcefld : sourceflds) {
String[] path = new String[] { "Seqdesc_source", "BioSource", "BioSource_org", "Org-ref",
"Org-ref_db", "Dbtag", "Dbtag_tag", "Object-id" };
JSONObject o = traverse(sourcefld, path);
org_id = new Long(o.getInt("Object-id_id"));
}
if (org_id == null) {
System.out.println("org_id == null. Multiple entries? We dont traverse down to the right desc for that case");
System.console().readLine();
}
return org_id;
// We have to navigate this structure to get to the Object-id_id value...
//
// {"Seqdesc_source": {"BioSource": {"BioSource_org": {"Org-ref": {
// "Org-ref_orgname": {"OrgName": {
// "OrgName_lineage": "Bacteria; Firmicutes; Bacilli; Bacillales; Bacillaceae; Geobacillus",
// "OrgName_div": "BCT",
// "OrgName_mod": {"OrgMod": {
// "OrgMod_subtype": {
// "value": "old-name",
// "content": 254
// },
// "OrgMod_subname": "Bacillus stearothermophilus"
// }},
// "OrgName_name": {"OrgName_name_binomial": {"BinomialOrgName": {
// "BinomialOrgName_genus": "Geobacillus",
// "BinomialOrgName_species": "stearothermophilus"
// }}},
// "OrgName_gcode": 11
// }},
// "Org-ref_taxname": "Geobacillus stearothermophilus",
// "Org-ref_db": {"Dbtag": {
// "Dbtag_tag": {"Object-id": {"Object-id_id": 1422}},
// "Dbtag_db": "taxon"
// }}
// }}}}},
}
private String extract_seq() {
// "Bioseq_inst": {"Seq-inst": {
// "Seq-inst_mol": {"value": "dna"},
// "Seq-inst_length": 1238,
// "Seq-inst_seq-data": {"Seq-data": {"Seq-data_iupacna": {"IUPACna": "GCATGCGCTCT
// OR
// "Bioseq_inst": {"Seq-inst": {
// "Seq-inst_mol": {"value": "aa"},
// "Seq-inst_length": 770,
// "Seq-inst_seq-data": {"Seq-data": {"Seq-data_iupacaa": {"IUPACaa": "MTT
String pathend_e, seq_e;
String[] type_path = new String[] {"Bioseq_inst", "Seq-inst", "Seq-inst_mol" };
String seq_type = traverse(this.data, type_path).getString("value");
// seq_type == dna | rna | aa
boolean dna = "dna".equals(seq_type);
boolean rna = "rna".equals(seq_type);
if (dna || rna) { // NT seq
pathend_e = "Seq-data_iupacna";
seq_e = "IUPACna";
} else { // AA seq
pathend_e = "Seq-data_iupacaa";
seq_e = "IUPACaa";
}
String[] seq_path = new String[] {"Bioseq_inst", "Seq-inst", "Seq-inst_seq-data", "Seq-data", pathend_e };
JSONObject o = traverse(this.data, seq_path);
String seq = o.getString(seq_e);
return seq;
}
private String extract_ec() {
// genbank entries dont seem to have the ec#
return null;
}
static JSONObject traverse(JSONObject container, String[] xpath) {
return traverse(container, xpath, 0);
}
static JSONObject traverse(JSONObject container, String[] xpath, int idx) {
if (idx == xpath.length)
return container;
else
return traverse(container.getJSONObject(xpath[idx]), xpath, idx + 1);
}
public String toString() {
return this.desc.toString() + " -> " + this.data.toString();
}
}
/*
Difference between rettype=native and rettype=fasta for NCBI genbank calls.
E.g.,
Case A] 16 lines in curl -s "http://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=protein&id=GI:6320033&rettype=fasta&retmode=xml"
Case B] 3209 lines in curl -s "http://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=protein&id=GI:6320033&rettype=native&retmode=xml" | wc -l
Case A] 16 lines from "fasta" have format:
{
"TSeqSet": {
"TSeq": {
"TSeq_seqtype": { "-value": "protein" },
"TSeq_gi": "6320033",
"TSeq_accver": "NP_010113.1",
"TSeq_taxid": "559292",
"TSeq_orgname": "Saccharomyces cerevisiae S288c",
"TSeq_defline": "bifunctional alcohol dehydrogenase/S-(hydroxymethyl)glutathione dehydrogenase [Saccharomyces cerevisiae S288c]",
"TSeq_length": "386",
"TSeq_sequence": "MSAATVGKPIKCIAAVAYDAKKPLSVEEITVDAPKAHEVRIKIEYTAVCHTDAYTLSGSDPEGLFPCVLGHEGAGIVESVGDDVITVKPGDHVIALYTAECGKCKFCTSGKTNLCGAVRATQGKGVMPDGTTRFHNAKGEDIYHFMGCSTFSEYTVVADVSVVAIDPKAPLDAACLLGCGVTTGFGAALKTANVQKGDTVAVFGCGTVGLSVIQGAKLRGASKIIAIDINNKKKQYCSQFGATDFVNPKEDLAKDQTIVEKLIEMTDGGLDFTFDCTGNTKIMRDALEACHKGWGQSIIIGVAAAGEEISTRPFQLVTGRVWKGSAFGGIKGRSEMGGLIKDYQKGALKVEEFITHRRPFKEINQAFEDLHNGDCLRTVLKSDEIK"
}
}
}
Case B] 3k lines (can go upto 1M+) from "native" have format:
{
"Bioseq-set": {
"Bioseq-set_seq-set": {
"Seq-entry": {
"Seq-entry_set": {
"Bioseq-set": {
"Bioseq-set_class": { "-value": "nuc-prot" },
"Bioseq-set_descr": {
"Seq-descr": {
"Seqdesc": [
{
"Seqdesc_source": {
"BioSource": {
"BioSource_genome": {
"-value": "chromosome",
"#text": "21"
},
"BioSource_org": {
"Org-ref": {
"Org-ref_taxname": "Saccharomyces cerevisiae S288c",
"Org-ref_db": {
"Dbtag": {
"Dbtag_db": "taxon",
"Dbtag_tag": {
"Object-id": { "Object-id_id": "559292" }
}
}
},
"Org-ref_orgname": {
"OrgName": {
"OrgName_name": {
"OrgName_name_binomial": {
"BinomialOrgName": {
"BinomialOrgName_genus": "Saccharomyces",
"BinomialOrgName_species": "cerevisiae"
}
}
},
"OrgName_mod": {
"OrgMod": {
"OrgMod_subtype": {
"-value": "strain",
"#text": "2"
},
"OrgMod_subname": "S288c"
}
},
"OrgName_lineage": "Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Saccharomyces",
"OrgName_gcode": "1",
"OrgName_mgcode": "3",
"OrgName_div": "PLN"
}
}
}
},
"BioSource_subtype": {
"SubSource": {
"SubSource_subtype": {
"-value": "chromosome",
"#text": "1"
},
"SubSource_name": "IV"
}
}
}
}
},
{
"Seqdesc_pub": {
"Pubdesc": {
"Pubdesc_pub": {
"Pub-equiv": {
"Pub": {
"Pub_sub": {
"Cit-sub": {
"Cit-sub_authors": {
"Auth-list": {
"Auth-list_names": {
"Auth-list_names_std": {
"Author": {
"Author_name": {
"Person-id": { "Person-id_consortium": "Saccharomyces Genome Database" }
}
}
}
},
"Auth-list_affil": {
"Affil": {
"Affil_std": {
"Affil_std_affil": "Stanford University",
"Affil_std_div": "Department of Genetics",
"Affil_std_city": "Stanford",
"Affil_std_sub": "CA",
"Affil_std_country": "USA",
"Affil_std_postal-code": "94305-5120"
}
}
}
}
},
"Cit-sub_date": {
"Date": {
"Date_std": {
"Date-std": {
"Date-std_year": "2009",
"Date-std_month": "12",
"Date-std_day": "11"
}
}
}
}
}
}
}
}
}
}
}
},
{
"Seqdesc_pub": {
"Pubdesc": {
"Pubdesc_pub": {
"Pub-equiv": {
"Pub": [
{
"Pub_article": {
"Cit-art": {
"Cit-art_title": {
"Title": {
"Title_E": { "Title_E_name": "The nucleotide sequence of Saccharomyces cerevisiae chromosome IV." }
}
},
"Cit-art_authors": {
"Auth-list": {
"Auth-list_names": {
"Auth-list_names_std": {
"Author": [
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Jacq",
"Name-std_first": "C",
"Name-std_initials": "C."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Alt-Morbe",
"Name-std_first": "J",
"Name-std_initials": "J."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Andre",
"Name-std_first": "B",
"Name-std_initials": "B."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Arnold",
"Name-std_first": "W",
"Name-std_initials": "W."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Bahr",
"Name-std_first": "A",
"Name-std_initials": "A."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Ballesta",
"Name-std_first": "J",
"Name-std_initials": "J.P."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Bargues",
"Name-std_first": "M",
"Name-std_initials": "M."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Baron",
"Name-std_first": "L",
"Name-std_initials": "L."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Becker",
"Name-std_first": "A",
"Name-std_initials": "A."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Biteau",
"Name-std_first": "N",
"Name-std_initials": "N."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Blocker",
"Name-std_first": "H",
"Name-std_initials": "H."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Blugeon",
"Name-std_first": "C",
"Name-std_initials": "C."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Boskovic",
"Name-std_first": "J",
"Name-std_initials": "J."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Brandt",
"Name-std_first": "P",
"Name-std_initials": "P."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Bruckner",
"Name-std_first": "M",
"Name-std_initials": "M."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Buitrago",
"Name-std_first": "M",
"Name-std_initials": "M.J."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Coster",
"Name-std_first": "F",
"Name-std_initials": "F."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Delaveau",
"Name-std_first": "T",
"Name-std_initials": "T."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "del Rey",
"Name-std_first": "F",
"Name-std_initials": "F."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Dujon",
"Name-std_first": "B",
"Name-std_initials": "B."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Eide",
"Name-std_first": "L",
"Name-std_initials": "L.G."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Garcia-Cantalejo",
"Name-std_first": "J",
"Name-std_initials": "J.M."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Goffeau",
"Name-std_first": "A",
"Name-std_initials": "A."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Gomez-Peris",
"Name-std_first": "A",
"Name-std_initials": "A."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Zaccaria",
"Name-std_first": "P",
"Name-std_initials": "P."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": { "Name-std_last": "et al." }
}
}
}
}
]
}
},
"Auth-list_affil": {
"Affil": { "Affil_str": "Laboratoire de Genetique Moleculaire, URA 1302 du CNRS, Ecole Normale Superieure, Paris, France. jacq@biologie.ens.fr" }
}
}
},
"Cit-art_from": {
"Cit-art_from_journal": {
"Cit-jour": {
"Cit-jour_title": {
"Title": {
"Title_E": [
{ "Title_E_iso-jta": "Nature" },
{ "Title_E_ml-jta": "Nature" },
{ "Title_E_issn": "0028-0836" },
{ "Title_E_name": "Nature" }
]
}
},
"Cit-jour_imp": {
"Imprint": {
"Imprint_date": {
"Date": {
"Date_std": {
"Date-std": {
"Date-std_year": "1997",
"Date-std_month": "5",
"Date-std_day": "29"
}
}
}
},
"Imprint_volume": "387",
"Imprint_issue": "6632",
"Imprint_pages": "75-78",
"Imprint_language": "eng",
"Imprint_part-supi": "SUPPL",
"Imprint_pubstatus": {
"PubStatus": {
"-value": "ppublish",
"#text": "4"
}
},
"Imprint_history": {
"PubStatusDateSet": {
"PubStatusDate": [
{
"PubStatusDate_pubstatus": {
"PubStatus": {
"-value": "pubmed",
"#text": "8"
}
},
"PubStatusDate_date": {
"Date": {
"Date_std": {
"Date-std": {
"Date-std_year": "1997",
"Date-std_month": "5",
"Date-std_day": "29"
}
}
}
}
},
{
"PubStatusDate_pubstatus": {
"PubStatus": {
"-value": "medline",
"#text": "12"
}
},
"PubStatusDate_date": {
"Date": {
"Date_std": {
"Date-std": {
"Date-std_year": "1997",
"Date-std_month": "5",
"Date-std_day": "29",
"Date-std_hour": "0",
"Date-std_minute": "1"
}
}
}
}
},
{
"PubStatusDate_pubstatus": {
"PubStatus": {
"-value": "other",
"#text": "255"
}
},
"PubStatusDate_date": {
"Date": {
"Date_std": {
"Date-std": {
"Date-std_year": "1997",
"Date-std_month": "5",
"Date-std_day": "29",
"Date-std_hour": "0",
"Date-std_minute": "0"
}
}
}
}
}
]
}
}
}
}
}
}
},
"Cit-art_ids": {
"ArticleIdSet": {
"ArticleId": {
"ArticleId_pubmed": { "PubMedId": "9169867" }
}
}
}
}
}
},
{
"Pub_pmid": { "PubMedId": "9169867" }
}
]
}
}
}
}
},
{
"Seqdesc_pub": {
"Pubdesc": {
"Pubdesc_pub": {
"Pub-equiv": {
"Pub": [
{
"Pub_article": {
"Cit-art": {
"Cit-art_title": {
"Title": {
"Title_E": { "Title_E_name": "Life with 6000 genes." }
}
},
"Cit-art_authors": {
"Auth-list": {
"Auth-list_names": {
"Auth-list_names_std": {
"Author": [
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Goffeau",
"Name-std_initials": "A."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Barrell",
"Name-std_initials": "B.G."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Bussey",
"Name-std_initials": "H."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Davis",
"Name-std_initials": "R.W."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Dujon",
"Name-std_initials": "B."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Feldmann",
"Name-std_initials": "H."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Galibert",
"Name-std_initials": "F."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Hoheisel",
"Name-std_initials": "J.D."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Jacq",
"Name-std_initials": "C."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Johnston",
"Name-std_initials": "M."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Louis",
"Name-std_initials": "E.J."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Mewes",
"Name-std_initials": "H.W."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Murakami",
"Name-std_initials": "Y."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Philippsen",
"Name-std_initials": "P."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Tettelin",
"Name-std_initials": "H."
}
}
}
}
},
{
"Author_name": {
"Person-id": {
"Person-id_name": {
"Name-std": {
"Name-std_last": "Oliver",
"Name-std_initials": "S.G."
}
}
}
}
}
]
}
},
"Auth-list_affil": {
"Affil": { "Affil_str": "Universite Catholique de Louvain, Unite de Biochimie Physiologique, Place Croix du Sud, 2/20, 1348 Louvain-la-Neuve, Belgium." }
}
}
},
"Cit-art_from": {
"Cit-art_from_journal": {
"Cit-jour": {
"Cit-jour_title": {
"Title": {
"Title_E": [
{ "Title_E_iso-jta": "Science" },
{ "Title_E_ml-jta": "Science" },
{ "Title_E_issn": "0036-8075" },
{ "Title_E_name": "Science (New York, N.Y.)" }
]
}
},
"Cit-jour_imp": {
"Imprint": {
"Imprint_date": {
"Date": {
"Date_std": {
"Date-std": {
"Date-std_year": "1996",
"Date-std_month": "10",
"Date-std_day": "25"
}
}
}
},
"Imprint_volume": "274",
"Imprint_issue": "5287",
"Imprint_pages": "546",
"Imprint_language": "eng",
"Imprint_pubstatus": {
"PubStatus": {
"-value": "ppublish",
"#text": "4"
}
},
"Imprint_history": {
"PubStatusDateSet": {
"PubStatusDate": [
{
"PubStatusDate_pubstatus": {
"PubStatus": {
"-value": "pubmed",
"#text": "8"
}
},
"PubStatusDate_date": {
"Date": {
"Date_std": {
"Date-std": {
"Date-std_year": "1996",
"Date-std_month": "10",
"Date-std_day": "25"
}
}
}
}
},
{
"PubStatusDate_pubstatus": {
"PubStatus": {
"-value": "medline",
"#text": "12"
}
},
"PubStatusDate_date": {
"Date": {
"Date_std": {
"Date-std": {
"Date-std_year": "1996",
"Date-std_month": "10",
"Date-std_day": "25",
"Date-std_hour": "0",
"Date-std_minute": "1"
}
}
}
}
},
{
"PubStatusDate_pubstatus": {
"PubStatus": {
"-value": "other",
"#text": "255"
}
},
"PubStatusDate_date": {
"Date": {
"Date_std": {
"Date-std": {
"Date-std_year": "1996",
"Date-std_month": "10",
"Date-std_day": "25",
"Date-std_hour": "0",
"Date-std_minute": "0"
}
}
}
}
}
]
}
}
}
}
}
}
},
"Cit-art_ids": {
"ArticleIdSet": {
"ArticleId": {
"ArticleId_pubmed": { "PubMedId": "8849441" }
}
}
}
}
}
},
{
"Pub_pmid": { "PubMedId": "8849441" }
}
]
}
}
}
}
},
{
"Seqdesc_pub": {
"Pubdesc": {
"Pubdesc_pub": {
"Pub-equiv": {
"Pub": {
"Pub_sub": {
"Cit-sub": {
"Cit-sub_authors": {
"Auth-list": {
"Auth-list_names": {
"Auth-list_names_std": {
"Author": {
"Author_name": {
"Person-id": { "Person-id_consortium": "Saccharomyces Genome Database" }
}
}
}
},
"Auth-list_affil": {
"Affil": {
"Affil_std": {
"Affil_std_affil": "Stanford University",
"Affil_std_div": "Department of Genetics",
"Affil_std_city": "Stanford",
"Affil_std_sub": "CA",
"Affil_std_country": "USA",
"Affil_std_postal-code": "94305-5120"
}
}
}
}
},
"Cit-sub_medium": { "-value": "other" },
"Cit-sub_date": {
"Date": {
"Date_std": {
"Date-std": {
"Date-std_year": "2011",
"Date-std_month": "3",
"Date-std_day": "31"
}
}
}
},
"Cit-sub_descr": "Sequence update by submitter"
}
}
}
}
}
}
}
},
{
"Seqdesc_pub": {
"Pubdesc": {
"Pubdesc_pub": {
"Pub-equiv": {
"Pub": {
"Pub_sub": {
"Cit-sub": {
"Cit-sub_authors": {
"Auth-list": {
"Auth-list_names": {
"Auth-list_names_std": {
"Author": {
"Author_name": {
"Person-id": { "Person-id_consortium": "Saccharomyces Genome Database" }
}
}
}
},
"Auth-list_affil": {
"Affil": {
"Affil_std": {
"Affil_std_affil": "Stanford University",
"Affil_std_div": "Department of Genetics",
"Affil_std_city": "Stanford",
"Affil_std_sub": "CA",
"Affil_std_country": "USA",
"Affil_std_postal-code": "94305-5120"
}
}
}
}
},
"Cit-sub_medium": { "-value": "other" },
"Cit-sub_date": {
"Date": {
"Date_std": {
"Date-std": {
"Date-std_year": "2012",
"Date-std_month": "5",
"Date-std_day": "4"
}
}
}
},
"Cit-sub_descr": "Protein update by submitter"
}
}
}
}
}
}
}
},
{
"Seqdesc_pub": {
"Pubdesc": {
"Pubdesc_pub": {
"Pub-equiv": {
"Pub": {
"Pub_sub": {
"Cit-sub": {
"Cit-sub_authors": {
"Auth-list": {
"Auth-list_names": {
"Auth-list_names_std": {
"Author": {
"Author_name": {
"Person-id": { "Person-id_consortium": "Saccharomyces Genome Database" }
}
}
}
},
"Auth-list_affil": {
"Affil": {
"Affil_std": {
"Affil_std_affil": "Stanford University",
"Affil_std_div": "Department of Genetics",
"Affil_std_city": "Stanford",
"Affil_std_sub": "CA",
"Affil_std_country": "USA",
"Affil_std_postal-code": "94305-5120"
}
}
}
}
},
"Cit-sub_medium": { "-value": "other" },
"Cit-sub_date": {
"Date": {
"Date_std": {
"Date-std": {
"Date-std_year": "2013",
"Date-std_month": "2",
"Date-std_day": "6"
}
}
}
},
"Cit-sub_descr": "Protein update by submitter"
}
}
}
}
}
}
}
},
{
"Seqdesc_pub": {
"Pubdesc": {
"Pubdesc_pub": {
"Pub-equiv": {
"Pub": {
"Pub_sub": {
"Cit-sub": {
"Cit-sub_authors": {
"Auth-list": {
"Auth-list_names": {
"Auth-list_names_std": {
"Author": {
"Author_name": {
"Person-id": { "Person-id_consortium": "Saccharomyces Genome Database" }
}
}
}
},
"Auth-list_affil": {
"Affil": {
"Affil_std": {
"Affil_std_affil": "Stanford University",
"Affil_std_div": "Department of Genetics",
"Affil_std_city": "Stanford",
"Affil_std_sub": "CA",
"Affil_std_country": "USA",
"Affil_std_postal-code": "94305-5120"
}
}
}
}
},
"Cit-sub_medium": { "-value": "other" },
"Cit-sub_date": {
"Date": {
"Date_std": {
"Date-std": {
"Date-std_year": "2015",
"Date-std_month": "1",
"Date-std_day": "16"
}
}
}
},
"Cit-sub_descr": "Protein update by submitter"
}
}
}
}
}
}
}
},
{
"Seqdesc_update-date": {
"Date": {
"Date_std": {
"Date-std": {
"Date-std_year": "2015",
"Date-std_month": "2",
"Date-std_day": "18"
}
}
}
}
}
]
}
},
"Bioseq-set_seq-set": {
"Seq-entry": [
{
"Seq-entry_seq": {
"Bioseq": {
"Bioseq_id": {
"Seq-id": [
{
"Seq-id_other": {
"Textseq-id": {
"Textseq-id_accession": "NM_001180228",
"Textseq-id_version": "1"
}
}
},
{ "Seq-id_gi": "296143201" }
]
},
"Bioseq_descr": {
"Seq-descr": {
"Seqdesc": [
{ "Seqdesc_title": "Saccharomyces cerevisiae S288c bifunctional alcohol dehydrogenase/S-(hydroxymethyl)glutathione dehydrogenase (SFA1), mRNA" },
{
"Seqdesc_molinfo": {
"MolInfo": {
"MolInfo_biomol": {
"-value": "mRNA",
"#text": "3"
}
}
}
},
{
"Seqdesc_user": {
"User-object": {
"User-object_type": {
"Object-id": { "Object-id_str": "RefGeneTracking" }
},
"User-object_data": {
"User-field": [
{
"User-field_label": {
"Object-id": { "Object-id_str": "GenomicSource" }
},
"User-field_data": { "User-field_data_str": "NC_001136" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "Status" }
},
"User-field_data": { "User-field_data_str": "PROVISIONAL" }
}
]
}
}
}
},
{
"Seqdesc_create-date": {
"Date": {
"Date_std": {
"Date-std": {
"Date-std_year": "2010",
"Date-std_month": "5",
"Date-std_day": "17"
}
}
}
}
}
]
}
},
"Bioseq_inst": {
"Seq-inst": {
"Seq-inst_repr": { "-value": "raw" },
"Seq-inst_mol": { "-value": "rna" },
"Seq-inst_length": "1161",
"Seq-inst_seq-data": {
"Seq-data": {
"Seq-data_iupacna": { "IUPACna": "ATGTCCGCCGCTACTGTTGGTAAACCTATTAAGTGCATTGCTGCTGTTGCGTATGATGCGAAGAAACCATTAAGTGTTGAAGAAATCACGGTAGACGCCCCAAAAGCGCACGAAGTACGTATCAAAATTGAATATACTGCTGTATGCCACACTGATGCGTACACTTTATCAGGCTCTGATCCAGAAGGACTTTTCCCTTGCGTTCTGGGCCACGAAGGAGCCGGTATCGTAGAATCTGTAGGCGATGATGTCATAACAGTTAAGCCTGGTGATCATGTTATTGCTTTGTACACTGCTGAGTGTGGCAAATGTAAGTTCTGTACTTCCGGTAAAACCAACTTATGTGGTGCTGTTAGAGCTACTCAAGGGAAAGGTGTAATGCCTGATGGGACCACAAGATTTCATAATGCGAAAGGTGAAGATATATACCATTTCATGGGTTGCTCTACTTTTTCCGAATATACTGTGGTGGCAGATGTCTCTGTGGTTGCCATCGATCCAAAAGCTCCCTTGGATGCTGCCTGTTTACTGGGTTGTGGTGTTACTACTGGTTTTGGGGCGGCTCTTAAGACAGCTAATGTGCAAAAAGGCGATACCGTTGCAGTATTTGGCTGCGGGACTGTAGGACTCTCCGTTATCCAAGGTGCAAAGTTAAGGGGCGCTTCCAAGATCATTGCCATTGACATTAACAATAAGAAAAAACAATATTGTTCTCAATTTGGTGCCACGGATTTTGTTAATCCCAAGGAAGATTTGGCCAAAGATCAAACTATCGTTGAAAAGTTAATTGAAATGACTGATGGGGGTCTGGATTTTACTTTTGACTGTACTGGTAATACCAAAATTATGAGAGATGCTTTGGAAGCCTGTCATAAAGGTTGGGGTCAATCTATTATCATTGGTGTGGCTGCCGCTGGTGAAGAAATTTCTACAAGGCCGTTCCAGCTGGTCACTGGTAGAGTGTGGAAAGGCTCTGCTTTTGGTGGCATCAAAGGTAGATCTGAAATGGGCGGTTTAATTAAAGACTATCAAAAAGGTGCCTTAAAAGTCGAAGAATTTATCACTCACAGGAGACCATTCAAAGAAATCAATCAAGCCTTTGAAGATTTGCATAACGGTGATTGCTTAAGAACCGTCTTGAAGTCTGATGAAATAAAATAG" }
}
}
}
},
"Bioseq_annot": {
"Seq-annot": {
"Seq-annot_data": {
"Seq-annot_data_ftable": {
"Seq-feat": {
"Seq-feat_data": {
"SeqFeatData": {
"SeqFeatData_gene": {
"Gene-ref": {
"Gene-ref_locus": "SFA1",
"Gene-ref_syn": { "Gene-ref_syn_E": "ADH5" },
"Gene-ref_locus-tag": "YDL168W"
}
}
}
},
"Seq-feat_location": {
"Seq-loc": {
"Seq-loc_int": {
"Seq-interval": {
"Seq-interval_from": "0",
"Seq-interval_to": "1160",
"Seq-interval_strand": {
"Na-strand": { "-value": "plus" }
},
"Seq-interval_id": {
"Seq-id": { "Seq-id_gi": "296143201" }
}
}
}
}
},
"Seq-feat_dbxref": {
"Dbtag": {
"Dbtag_db": "GeneID",
"Dbtag_tag": {
"Object-id": { "Object-id_id": "851386" }
}
}
}
}
}
}
}
}
}
}
},
{
"Seq-entry_seq": {
"Bioseq": {
"Bioseq_id": {
"Seq-id": [
{
"Seq-id_other": {
"Textseq-id": {
"Textseq-id_accession": "NP_010113",
"Textseq-id_version": "1"
}
}
},
{ "Seq-id_gi": "6320033" }
]
},
"Bioseq_descr": {
"Seq-descr": {
"Seqdesc": [
{
"Seqdesc_title": "bifunctional alcohol dehydrogenase/S-(hydroxymethyl)glutathione dehydrogenase [Saccharomyces cerevisiae S288c]"
},
{
"Seqdesc_molinfo": {
"MolInfo": {
"MolInfo_biomol": {
"-value": "peptide",
"#text": "8"
},
"MolInfo_tech": {
"-value": "concept-trans",
"#text": "8"
}
}
}
},
{
"Seqdesc_user": {
"User-object": {
"User-object_type": {
"Object-id": { "Object-id_str": "RefGeneTracking" }
},
"User-object_data": {
"User-field": [
{
"User-field_label": {
"Object-id": { "Object-id_str": "IdenticalTo" }
},
"User-field_data": {
"User-field_data_fields": {
"User-field": {
"User-field_label": {
"Object-id": { "Object-id_id": "0" }
},
"User-field_data": {
"User-field_data_fields": {
"User-field": [
{
"User-field_label": {
"Object-id": { "Object-id_str": "accession" }
},
"User-field_data": { "User-field_data_str": "DAA11693" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "gi" }
},
"User-field_data": { "User-field_data_int": "285810869" }
}
]
}
}
}
}
}
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "Status" }
},
"User-field_data": { "User-field_data_str": "PROVISIONAL" }
}
]
}
}
}
},
{
"Seqdesc_create-date": {
"Date": {
"Date_std": {
"Date-std": {
"Date-std_year": "1999",
"Date-std_month": "11",
"Date-std_day": "9"
}
}
}
}
}
]
}
},
"Bioseq_inst": {
"Seq-inst": {
"Seq-inst_repr": { "-value": "raw" },
"Seq-inst_mol": { "-value": "aa" },
"Seq-inst_length": "386",
"Seq-inst_seq-data": {
"Seq-data": {
"Seq-data_iupacaa": { "IUPACaa": "MSAATVGKPIKCIAAVAYDAKKPLSVEEITVDAPKAHEVRIKIEYTAVCHTDAYTLSGSDPEGLFPCVLGHEGAGIVESVGDDVITVKPGDHVIALYTAECGKCKFCTSGKTNLCGAVRATQGKGVMPDGTTRFHNAKGEDIYHFMGCSTFSEYTVVADVSVVAIDPKAPLDAACLLGCGVTTGFGAALKTANVQKGDTVAVFGCGTVGLSVIQGAKLRGASKIIAIDINNKKKQYCSQFGATDFVNPKEDLAKDQTIVEKLIEMTDGGLDFTFDCTGNTKIMRDALEACHKGWGQSIIIGVAAAGEEISTRPFQLVTGRVWKGSAFGGIKGRSEMGGLIKDYQKGALKVEEFITHRRPFKEINQAFEDLHNGDCLRTVLKSDEIK" }
}
}
}
},
"Bioseq_annot": {
"Seq-annot": [
{
"Seq-annot_data": {
"Seq-annot_data_ftable": {
"Seq-feat": {
"Seq-feat_id": {
"Feat-id": {
"Feat-id_local": {
"Object-id": { "Object-id_id": "6568" }
}
}
},
"Seq-feat_data": {
"SeqFeatData": {
"SeqFeatData_prot": {
"Prot-ref": {
"Prot-ref_name": { "Prot-ref_name_E": "bifunctional alcohol dehydrogenase/S-(hydroxymethyl)glutathione dehydrogenase" },
"Prot-ref_ec": {
"Prot-ref_ec_E": [
"1.1.1.-",
"1.1.1.284",
"1.1.1.1"
]
}
}
}
}
},
"Seq-feat_location": {
"Seq-loc": {
"Seq-loc_int": {
"Seq-interval": {
"Seq-interval_from": "0",
"Seq-interval_to": "385",
"Seq-interval_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
}
}
}
}
}
},
{
"Seq-annot_db": {
"-value": "other",
"#text": "255"
},
"Seq-annot_name": "Annot:CDD",
"Seq-annot_desc": {
"Annot-descr": {
"Annotdesc": [
{ "Annotdesc_name": "CddSearch" },
{
"Annotdesc_user": {
"User-object": {
"User-object_type": {
"Object-id": { "Object-id_str": "CddInfo" }
},
"User-object_data": {
"User-field": {
"User-field_label": {
"Object-id": { "Object-id_str": "version" }
},
"User-field_data": { "User-field_data_str": "3.11" }
}
}
}
}
},
{
"Annotdesc_create-date": {
"Date": {
"Date_std": {
"Date-std": {
"Date-std_year": "2014",
"Date-std_month": "2",
"Date-std_day": "28",
"Date-std_hour": "14",
"Date-std_minute": "51",
"Date-std_second": "48"
}
}
}
}
}
]
}
},
"Seq-annot_data": {
"Seq-annot_data_ftable": {
"Seq-feat": [
{
"Seq-feat_data": {
"SeqFeatData": { "SeqFeatData_region": "alcohol_DH_class_III" }
},
"Seq-feat_comment": "class III alcohol dehydrogenases",
"Seq-feat_location": {
"Seq-loc": {
"Seq-loc_int": {
"Seq-interval": {
"Seq-interval_from": "9",
"Seq-interval_to": "380",
"Seq-interval_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
}
},
"Seq-feat_ext": {
"User-object": {
"User-object_type": {
"Object-id": { "Object-id_str": "cddScoreData" }
},
"User-object_data": {
"User-field": [
{
"User-field_label": {
"Object-id": { "Object-id_str": "domain_from" }
},
"User-field_data": { "User-field_data_int": "0" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "domain_to" }
},
"User-field_data": { "User-field_data_int": "367" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "definition" }
},
"User-field_data": { "User-field_data_str": "cd08300" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "short_name" }
},
"User-field_data": { "User-field_data_str": "alcohol_DH_class_III" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "score" }
},
"User-field_data": { "User-field_data_int": "1838" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "evalue" }
},
"User-field_data": { "User-field_data_real": "0" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "bit_score" }
},
"User-field_data": { "User-field_data_real": "711.692" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "specific" }
},
"User-field_data": {
"User-field_data_bool": { "-value": "true" }
}
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "superfamily" }
},
"User-field_data": { "User-field_data_str": "cl16912" }
}
]
}
}
},
"Seq-feat_dbxref": {
"Dbtag": {
"Dbtag_db": "CDD",
"Dbtag_tag": {
"Object-id": { "Object-id_id": "176260" }
}
}
}
},
{
"Seq-feat_data": {
"SeqFeatData": { "SeqFeatData_region": "AdhC" }
},
"Seq-feat_comment": "Zn-dependent alcohol dehydrogenases, class III [Energy production and conversion]",
"Seq-feat_location": {
"Seq-loc": {
"Seq-loc_int": {
"Seq-interval": {
"Seq-interval_from": "9",
"Seq-interval_to": "380",
"Seq-interval_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
}
},
"Seq-feat_ext": {
"User-object": {
"User-object_type": {
"Object-id": { "Object-id_str": "cddScoreData" }
},
"User-object_data": {
"User-field": [
{
"User-field_label": {
"Object-id": { "Object-id_str": "domain_from" }
},
"User-field_data": { "User-field_data_int": "0" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "domain_to" }
},
"User-field_data": { "User-field_data_int": "364" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "definition" }
},
"User-field_data": { "User-field_data_str": "COG1062" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "short_name" }
},
"User-field_data": { "User-field_data_str": "AdhC" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "score" }
},
"User-field_data": { "User-field_data_int": "1496" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "evalue" }
},
"User-field_data": { "User-field_data_real": "0" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "bit_score" }
},
"User-field_data": { "User-field_data_real": "579.947" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "specific" }
},
"User-field_data": {
"User-field_data_bool": { "-value": "true" }
}
}
]
}
}
},
"Seq-feat_dbxref": {
"Dbtag": {
"Dbtag_db": "CDD",
"Dbtag_tag": {
"Object-id": { "Object-id_id": "223990" }
}
}
}
},
{
"Seq-feat_data": {
"SeqFeatData": {
"SeqFeatData_site": { "-value": "other" }
}
},
"Seq-feat_comment": "NAD binding site [chemical binding]",
"Seq-feat_location": {
"Seq-loc": {
"Seq-loc_mix": {
"Seq-loc-mix": {
"Seq-loc": [
{
"Seq-loc_int": {
"Seq-interval": {
"Seq-interval_from": "49",
"Seq-interval_to": "50",
"Seq-interval_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_pnt": {
"Seq-point": {
"Seq-point_point": "178",
"Seq-point_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_pnt": {
"Seq-point": {
"Seq-point_point": "182",
"Seq-point_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_int": {
"Seq-interval": {
"Seq-interval_from": "203",
"Seq-interval_to": "207",
"Seq-interval_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_int": {
"Seq-interval": {
"Seq-interval_from": "227",
"Seq-interval_to": "228",
"Seq-interval_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_pnt": {
"Seq-point": {
"Seq-point_point": "232",
"Seq-point_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_int": {
"Seq-interval": {
"Seq-interval_from": "275",
"Seq-interval_to": "276",
"Seq-interval_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_int": {
"Seq-interval": {
"Seq-interval_from": "280",
"Seq-interval_to": "281",
"Seq-interval_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_int": {
"Seq-interval": {
"Seq-interval_from": "299",
"Seq-interval_to": "300",
"Seq-interval_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_int": {
"Seq-interval": {
"Seq-interval_from": "324",
"Seq-interval_to": "326",
"Seq-interval_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_pnt": {
"Seq-point": {
"Seq-point_point": "376",
"Seq-point_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
}
]
}
}
}
},
"Seq-feat_ext": {
"User-object": {
"User-object_type": {
"Object-id": { "Object-id_str": "cddSiteScoreData" }
},
"User-object_data": {
"User-field": [
{
"User-field_label": {
"Object-id": { "Object-id_str": "completeness" }
},
"User-field_data": { "User-field_data_real": "1" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "feature-ID" }
},
"User-field_data": { "User-field_data_int": "0" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "specific" }
},
"User-field_data": {
"User-field_data_bool": { "-value": "true" }
}
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "nonredundant" }
},
"User-field_data": {
"User-field_data_bool": { "-value": "true" }
}
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "definition" }
},
"User-field_data": { "User-field_data_str": "cd08300" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "short_name" }
},
"User-field_data": { "User-field_data_str": "alcohol_DH_class_III" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "from" }
},
"User-field_data": { "User-field_data_int": "9" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "to" }
},
"User-field_data": { "User-field_data_int": "380" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "score" }
},
"User-field_data": { "User-field_data_int": "1838" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "evalue" }
},
"User-field_data": { "User-field_data_real": "0" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "bit_score" }
},
"User-field_data": { "User-field_data_real": "711.692" }
}
]
}
}
},
"Seq-feat_dbxref": {
"Dbtag": {
"Dbtag_db": "CDD",
"Dbtag_tag": {
"Object-id": { "Object-id_id": "176260" }
}
}
}
},
{
"Seq-feat_data": {
"SeqFeatData": {
"SeqFeatData_site": { "-value": "other" }
}
},
"Seq-feat_comment": "substrate binding site [chemical binding]",
"Seq-feat_location": {
"Seq-loc": {
"Seq-loc_mix": {
"Seq-loc-mix": {
"Seq-loc": [
{
"Seq-loc_pnt": {
"Seq-point": {
"Seq-point_point": "48",
"Seq-point_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_pnt": {
"Seq-point": {
"Seq-point_point": "50",
"Seq-point_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_int": {
"Seq-interval": {
"Seq-interval_from": "59",
"Seq-interval_to": "61",
"Seq-interval_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_pnt": {
"Seq-point": {
"Seq-point_point": "70",
"Seq-point_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_int": {
"Seq-interval": {
"Seq-interval_from": "96",
"Seq-interval_to": "97",
"Seq-interval_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_pnt": {
"Seq-point": {
"Seq-point_point": "178",
"Seq-point_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_pnt": {
"Seq-point": {
"Seq-point_point": "301",
"Seq-point_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_pnt": {
"Seq-point": {
"Seq-point_point": "325",
"Seq-point_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
}
]
}
}
}
},
"Seq-feat_ext": {
"User-object": {
"User-object_type": {
"Object-id": { "Object-id_str": "cddSiteScoreData" }
},
"User-object_data": {
"User-field": [
{
"User-field_label": {
"Object-id": { "Object-id_str": "completeness" }
},
"User-field_data": { "User-field_data_real": "1" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "feature-ID" }
},
"User-field_data": { "User-field_data_int": "1" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "specific" }
},
"User-field_data": {
"User-field_data_bool": { "-value": "true" }
}
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "nonredundant" }
},
"User-field_data": {
"User-field_data_bool": { "-value": "true" }
}
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "definition" }
},
"User-field_data": { "User-field_data_str": "cd08300" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "short_name" }
},
"User-field_data": { "User-field_data_str": "alcohol_DH_class_III" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "from" }
},
"User-field_data": { "User-field_data_int": "9" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "to" }
},
"User-field_data": { "User-field_data_int": "380" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "score" }
},
"User-field_data": { "User-field_data_int": "1838" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "evalue" }
},
"User-field_data": { "User-field_data_real": "0" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "bit_score" }
},
"User-field_data": { "User-field_data_real": "711.692" }
}
]
}
}
},
"Seq-feat_dbxref": {
"Dbtag": {
"Dbtag_db": "CDD",
"Dbtag_tag": {
"Object-id": { "Object-id_id": "176260" }
}
}
}
},
{
"Seq-feat_data": {
"SeqFeatData": {
"SeqFeatData_site": { "-value": "other" }
}
},
"Seq-feat_comment": "dimer interface [polypeptide binding]",
"Seq-feat_location": {
"Seq-loc": {
"Seq-loc_mix": {
"Seq-loc-mix": {
"Seq-loc": [
{
"Seq-loc_int": {
"Seq-interval": {
"Seq-interval_from": "104",
"Seq-interval_to": "105",
"Seq-interval_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_pnt": {
"Seq-point": {
"Seq-point_point": "108",
"Seq-point_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_int": {
"Seq-interval": {
"Seq-interval_from": "110",
"Seq-interval_to": "111",
"Seq-interval_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_pnt": {
"Seq-point": {
"Seq-point_point": "113",
"Seq-point_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_pnt": {
"Seq-point": {
"Seq-point_point": "115",
"Seq-point_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_pnt": {
"Seq-point": {
"Seq-point_point": "266",
"Seq-point_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_pnt": {
"Seq-point": {
"Seq-point_point": "271",
"Seq-point_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_int": {
"Seq-interval": {
"Seq-interval_from": "282",
"Seq-interval_to": "283",
"Seq-interval_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_int": {
"Seq-interval": {
"Seq-interval_from": "290",
"Seq-interval_to": "293",
"Seq-interval_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_pnt": {
"Seq-point": {
"Seq-point_point": "302",
"Seq-point_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_int": {
"Seq-interval": {
"Seq-interval_from": "305",
"Seq-interval_to": "312",
"Seq-interval_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_int": {
"Seq-interval": {
"Seq-interval_from": "315",
"Seq-interval_to": "317",
"Seq-interval_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_int": {
"Seq-interval": {
"Seq-interval_from": "320",
"Seq-interval_to": "325",
"Seq-interval_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
}
]
}
}
}
},
"Seq-feat_ext": {
"User-object": {
"User-object_type": {
"Object-id": { "Object-id_str": "cddSiteScoreData" }
},
"User-object_data": {
"User-field": [
{
"User-field_label": {
"Object-id": { "Object-id_str": "completeness" }
},
"User-field_data": { "User-field_data_real": "1" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "feature-ID" }
},
"User-field_data": { "User-field_data_int": "2" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "specific" }
},
"User-field_data": {
"User-field_data_bool": { "-value": "true" }
}
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "nonredundant" }
},
"User-field_data": {
"User-field_data_bool": { "-value": "true" }
}
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "definition" }
},
"User-field_data": { "User-field_data_str": "cd08300" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "short_name" }
},
"User-field_data": { "User-field_data_str": "alcohol_DH_class_III" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "from" }
},
"User-field_data": { "User-field_data_int": "9" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "to" }
},
"User-field_data": { "User-field_data_int": "380" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "score" }
},
"User-field_data": { "User-field_data_int": "1838" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "evalue" }
},
"User-field_data": { "User-field_data_real": "0" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "bit_score" }
},
"User-field_data": { "User-field_data_real": "711.692" }
}
]
}
}
},
"Seq-feat_dbxref": {
"Dbtag": {
"Dbtag_db": "CDD",
"Dbtag_tag": {
"Object-id": { "Object-id_id": "176260" }
}
}
}
},
{
"Seq-feat_data": {
"SeqFeatData": {
"SeqFeatData_site": { "-value": "other" }
}
},
"Seq-feat_comment": "catalytic Zn binding site [ion binding]",
"Seq-feat_location": {
"Seq-loc": {
"Seq-loc_mix": {
"Seq-loc-mix": {
"Seq-loc": [
{
"Seq-loc_pnt": {
"Seq-point": {
"Seq-point_point": "48",
"Seq-point_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_int": {
"Seq-interval": {
"Seq-interval_from": "70",
"Seq-interval_to": "71",
"Seq-interval_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_pnt": {
"Seq-point": {
"Seq-point_point": "178",
"Seq-point_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
}
]
}
}
}
},
"Seq-feat_ext": {
"User-object": {
"User-object_type": {
"Object-id": { "Object-id_str": "cddSiteScoreData" }
},
"User-object_data": {
"User-field": [
{
"User-field_label": {
"Object-id": { "Object-id_str": "completeness" }
},
"User-field_data": { "User-field_data_real": "1" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "feature-ID" }
},
"User-field_data": { "User-field_data_int": "3" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "specific" }
},
"User-field_data": {
"User-field_data_bool": { "-value": "true" }
}
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "nonredundant" }
},
"User-field_data": {
"User-field_data_bool": { "-value": "true" }
}
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "definition" }
},
"User-field_data": { "User-field_data_str": "cd08300" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "short_name" }
},
"User-field_data": { "User-field_data_str": "alcohol_DH_class_III" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "from" }
},
"User-field_data": { "User-field_data_int": "9" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "to" }
},
"User-field_data": { "User-field_data_int": "380" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "score" }
},
"User-field_data": { "User-field_data_int": "1838" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "evalue" }
},
"User-field_data": { "User-field_data_real": "0" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "bit_score" }
},
"User-field_data": { "User-field_data_real": "711.692" }
}
]
}
}
},
"Seq-feat_dbxref": {
"Dbtag": {
"Dbtag_db": "CDD",
"Dbtag_tag": {
"Object-id": { "Object-id_id": "176260" }
}
}
}
},
{
"Seq-feat_data": {
"SeqFeatData": {
"SeqFeatData_site": { "-value": "other" }
}
},
"Seq-feat_comment": "structural Zn binding site [ion binding]",
"Seq-feat_location": {
"Seq-loc": {
"Seq-loc_mix": {
"Seq-loc-mix": {
"Seq-loc": [
{
"Seq-loc_pnt": {
"Seq-point": {
"Seq-point_point": "100",
"Seq-point_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_pnt": {
"Seq-point": {
"Seq-point_point": "103",
"Seq-point_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_pnt": {
"Seq-point": {
"Seq-point_point": "106",
"Seq-point_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
},
{
},
{
"Seq-loc_pnt": {
"Seq-point": {
"Seq-point_point": "114",
"Seq-point_id": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
}
}
]
}
}
}
},
"Seq-feat_ext": {
"User-object": {
"User-object_type": {
"Object-id": { "Object-id_str": "cddSiteScoreData" }
},
"User-object_data": {
"User-field": [
{
"User-field_label": {
"Object-id": { "Object-id_str": "completeness" }
},
"User-field_data": { "User-field_data_real": "1" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "feature-ID" }
},
"User-field_data": { "User-field_data_int": "4" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "specific" }
},
"User-field_data": {
"User-field_data_bool": { "-value": "true" }
}
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "nonredundant" }
},
"User-field_data": {
"User-field_data_bool": { "-value": "true" }
}
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "definition" }
},
"User-field_data": { "User-field_data_str": "cd08300" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "short_name" }
},
"User-field_data": { "User-field_data_str": "alcohol_DH_class_III" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "from" }
},
"User-field_data": { "User-field_data_int": "9" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "to" }
},
"User-field_data": { "User-field_data_int": "380" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "score" }
},
"User-field_data": { "User-field_data_int": "1838" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "evalue" }
},
"User-field_data": { "User-field_data_real": "0" }
},
{
"User-field_label": {
"Object-id": { "Object-id_str": "bit_score" }
},
"User-field_data": { "User-field_data_real": "711.692" }
}
]
}
}
},
"Seq-feat_dbxref": {
"Dbtag": {
"Dbtag_db": "CDD",
"Dbtag_tag": {
"Object-id": { "Object-id_id": "176260" }
}
}
}
}
]
}
}
}
]
}
}
}
}
]
},
"Bioseq-set_annot": {
"Seq-annot": {
"Seq-annot_data": {
"Seq-annot_data_ftable": {
"Seq-feat": {
"Seq-feat_data": {
"SeqFeatData": {
"SeqFeatData_cdregion": {
"Cdregion": {
"Cdregion_frame": { "-value": "one" },
"Cdregion_code": {
"Genetic-code": {
"Genetic-code_E": { "Genetic-code_E_id": "1" }
}
}
}
}
}
},
"Seq-feat_comment": "Bifunctional alcohol dehydrogenase and formaldehyde dehydrogenase; formaldehyde dehydrogenase activity is glutathione-dependent; functions in formaldehyde detoxification and formation of long chain and complex alcohols, regulated by Hog1p-Sko1p; protein abundance increases in response to DNA replication stress",
"Seq-feat_product": {
"Seq-loc": {
"Seq-loc_whole": {
"Seq-id": { "Seq-id_gi": "6320033" }
}
}
},
"Seq-feat_location": {
"Seq-loc": {
"Seq-loc_int": {
"Seq-interval": {
"Seq-interval_from": "0",
"Seq-interval_to": "1160",
"Seq-interval_strand": {
"Na-strand": { "-value": "plus" }
},
"Seq-interval_id": {
"Seq-id": { "Seq-id_gi": "296143201" }
}
}
}
}
},
"Seq-feat_dbxref": {
"Dbtag": {
"Dbtag_db": "SGD",
"Dbtag_tag": {
"Object-id": { "Object-id_str": "S000002327" }
}
}
}
}
}
}
}
}
}
}
}
}
}
}
*/