/*
VARNA is a tool for the automated drawing, visualization and annotation of the secondary structure of RNA, designed as a companion software for web servers and databases.
Copyright (C) 2008 Kevin Darty, Alain Denise and Yann Ponty.
electronic mail : Yann.Ponty@lri.fr
paper mail : LRI, bat 490 University Paris-Sud 91405 Orsay Cedex France
This file is part of VARNA version 3.1.
VARNA version 3.1 is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License
as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
VARNA version 3.1 is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY;
without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
See the GNU General Public License for more details.
You should have received a copy of the GNU General Public License along with VARNA version 3.1.
If not, see http://www.gnu.org/licenses.
*/
package fr.orsay.lri.varna.applications;
/*
VARNA is a Java library for quick automated drawings RNA secondary structure
Copyright (C) 2007 Yann Ponty
This program is free software:you can redistribute it and/or modify
it under the terms of the GNU General Public License as published by
the Free Software Foundation, either version 3 of the License, or
(at your option) any later version.
This program is distributed in the hope that it will be useful,
but WITHOUT ANY WARRANTY; without even the implied warranty of
MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
GNU General Public License for more details.
You should have received a copy of the GNU General Public License
along with this program. If not, see <http://www.gnu.org/licenses/>.
*/
import java.awt.BorderLayout;
import java.awt.Color;
import java.awt.Dimension;
import java.awt.Font;
import java.awt.GridLayout;
import javax.swing.JApplet;
import javax.swing.JLabel;
import javax.swing.JPanel;
import javax.swing.JTextField;
import fr.orsay.lri.varna.VARNAPanel;
import fr.orsay.lri.varna.controlers.ControleurDemoTextField;
import fr.orsay.lri.varna.exceptions.ExceptionNonEqualLength;
import fr.orsay.lri.varna.models.rna.RNA;
/**
* An RNA 2d Panel demo applet
*
* @author Yann Ponty & Darty Kévin
*
*/
public class VARNAOnlineDemo extends JApplet {
/**
*
*/
private static final long serialVersionUID = -790155708306987257L;
private static final String DEFAULT_SEQUENCE = "CAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIA";
private static final String DEFAULT_STRUCTURE = "..(((((...(((((...(((((...(((((.....)))))...))))).....(((((...(((((.....)))))...))))).....)))))...)))))..";
private VARNAPanel _vp;
private JPanel _tools = new JPanel();
private JPanel _input = new JPanel();
private JPanel _seqPanel = new JPanel();
private JPanel _structPanel = new JPanel();
private JLabel _info = new JLabel();
private JTextField _struct = new JTextField();
private JTextField _seq = new JTextField();
private JLabel _structLabel = new JLabel(" Str:");
private JLabel _seqLabel = new JLabel(" Seq:");
private static String errorOpt = "error";
private boolean _error;
private Color _backgroundColor = Color.white;
private int _algoCode;
public VARNAOnlineDemo() {
super();
try {
_vp = new VARNAPanel(_seq.getText(), _struct.getText());
_vp.setErrorsOn(false);
} catch (ExceptionNonEqualLength e) {
_vp.errorDialog(e);
}
RNAPanelDemoInit();
}
private void RNAPanelDemoInit() {
int marginTools = 40;
setBackground(_backgroundColor);
_vp.setBackground(_backgroundColor);
try {
_vp.getRNA().setRNA(_seq.getText(), _struct.getText());
_vp.setErrorsOn(false);
} catch (Exception e1) {
_vp.errorDialog(e1);
}
Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12");
_seqLabel.setHorizontalTextPosition(JLabel.LEFT);
_seqLabel.setPreferredSize(new Dimension(marginTools, 15));
_seq.setFont(textFieldsFont);
_seq.setText(_vp.getRNA().getSeq());
_seqPanel.setLayout(new BorderLayout());
_seqPanel.add(_seqLabel, BorderLayout.WEST);
_seqPanel.add(_seq, BorderLayout.CENTER);
_structLabel.setPreferredSize(new Dimension(marginTools, 15));
_structLabel.setHorizontalTextPosition(JLabel.LEFT);
_struct.setFont(textFieldsFont);
_struct.setText(_vp.getRNA().getStructDBN());
_structPanel.setLayout(new BorderLayout());
_structPanel.add(_structLabel, BorderLayout.WEST);
_structPanel.add(_struct, BorderLayout.CENTER);
ControleurDemoTextField controleurTextField = new ControleurDemoTextField(this);
_seq.addCaretListener(controleurTextField);
_struct.addCaretListener(controleurTextField);
_input.setLayout(new GridLayout(3, 0));
_input.add(_seqPanel);
_input.add(_structPanel);
_tools.setLayout(new BorderLayout());
_tools.add(_input, BorderLayout.CENTER);
_tools.add(_info, BorderLayout.SOUTH);
getContentPane().setLayout(new BorderLayout());
getContentPane().add(_vp, BorderLayout.CENTER);
getContentPane().add(_tools, BorderLayout.SOUTH);
setVisible(true);
_vp.getVARNAUI().UIRadiate();
}
public String[][] getParameterInfo() {
String[][] info = {
// Parameter Name Kind of Value Description,
{ "sequenceDBN", "String", "A raw RNA sequence" },
{ "structureDBN", "String",
"An RNA structure in dot bracket notation (DBN)" },
{ errorOpt, "boolean", "To show errors" }, };
return info;
}
public void init() {
retrieveParametersValues();
_vp.setBackground(_backgroundColor);
_error = true;
}
private Color getSafeColor(String col, Color def) {
Color result;
try {
result = Color.decode(col);
} catch (Exception e) {
try {
result = Color.getColor(col, def);
} catch (Exception e2) {
return def;
}
}
return result;
}
private String getParameterValue(String key, String def) {
String tmp;
tmp = getParameter(key);
if (tmp == null) {
return def;
} else {
return tmp;
}
}
private void retrieveParametersValues() {
_error = Boolean.parseBoolean(getParameterValue(errorOpt, "false"));
_vp.setErrorsOn(_error);
_backgroundColor = getSafeColor(getParameterValue("background",
_backgroundColor.toString()), _backgroundColor);
_vp.setBackground(_backgroundColor);
_seq.setText(getParameterValue("sequenceDBN", ""));
_struct.setText(getParameterValue("structureDBN", ""));
String _algo = getParameterValue("algorithm", "radiate");
if (_algo.equals("circular"))
_algoCode = RNA.DRAW_MODE_CIRCULAR;
else if (_algo.equals("naview"))
_algoCode = RNA.DRAW_MODE_NAVIEW;
else if (_algo.equals("line"))
_algoCode = RNA.DRAW_MODE_LINEAR;
else
_algoCode = RNA.DRAW_MODE_RADIATE;
if (_seq.getText().equals("") && _struct.getText().equals("")) {
_seq.setText(DEFAULT_SEQUENCE);
_struct.setText(DEFAULT_STRUCTURE);
}
try {
_vp.drawRNA(_seq.getText(), _struct.getText(), _algoCode);
} catch (ExceptionNonEqualLength e) {
e.printStackTrace();
}
}
public VARNAPanel get_varnaPanel() {
return _vp;
}
public void set_varnaPanel(VARNAPanel surface) {
_vp = surface;
}
public JTextField get_struct() {
return _struct;
}
public void set_struct(JTextField _struct) {
this._struct = _struct;
}
public JTextField get_seq() {
return _seq;
}
public void set_seq(JTextField _seq) {
this._seq = _seq;
}
public JLabel get_info() {
return _info;
}
public void set_info(JLabel _info) {
this._info = _info;
}
}