package edu.princeton.cs.algs4.ch55; import edu.princeton.cs.algs4.ch51.Alphabet; import edu.princeton.cs.introcs.*; /************************************************************************* * Compilation: javac Genome.java * Execution: java Genome - < input.txt (compress) * Execution: java Genome + < input.txt (expand) * Dependencies: BinaryIn.java BinaryOut.java * * Compress or expand a genomic sequence using a 2-bit code. * * % more genomeTiny.txt * ATAGATGCATAGCGCATAGCTAGATGTGCTAGC * * % java Genome - < genomeTiny.txt | java Genome + * ATAGATGCATAGCGCATAGCTAGATGTGCTAGC * *************************************************************************/ public class Genome { public static void compress() { Alphabet DNA = new Alphabet("ACTG"); String s = BinaryStdIn.readString(); int N = s.length(); BinaryStdOut.write(N); // Write two-bit code for char. for (int i = 0; i < N; i++) { int d = DNA.toIndex(s.charAt(i)); BinaryStdOut.write(d, 2); } BinaryStdOut.close(); } public static void expand() { Alphabet DNA = new Alphabet("ACTG"); int N = BinaryStdIn.readInt(); // Read two bits; write char. for (int i = 0; i < N; i++) { char c = BinaryStdIn.readChar(2); BinaryStdOut.write(DNA.toChar(c), 8); } BinaryStdOut.close(); } public static void main(String[] args) { if (args[0].equals("-")) compress(); else if (args[0].equals("+")) expand(); else throw new IllegalArgumentException("Illegal command line argument"); } } /************************************************************************* * Copyright 2002-2012, Robert Sedgewick and Kevin Wayne. * * This file is part of algs4-package.jar, which accompanies the textbook * * Algorithms, 4th edition by Robert Sedgewick and Kevin Wayne, * Addison-Wesley Professional, 2011, ISBN 0-321-57351-X. * http://algs4.cs.princeton.edu * * * algs4-package.jar is free software: you can redistribute it and/or modify * it under the terms of the GNU General Public License as published by * the Free Software Foundation, either version 3 of the License, or * (at your option) any later version. * * algs4-package.jar is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU General Public License for more details. * You should have received a copy of the GNU General Public License * along with algs4-package.jar. If not, see http://www.gnu.org/licenses. *************************************************************************/