/*
VARNA is a tool for the automated drawing, visualization and annotation of the secondary structure of RNA, designed as a companion software for web servers and databases.
Copyright (C) 2008 Kevin Darty, Alain Denise and Yann Ponty.
electronic mail : Yann.Ponty@lri.fr
paper mail : LRI, bat 490 University Paris-Sud 91405 Orsay Cedex France
This file is part of VARNA version 3.1.
VARNA version 3.1 is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License
as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
VARNA version 3.1 is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY;
without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
See the GNU General Public License for more details.
You should have received a copy of the GNU General Public License along with VARNA version 3.1.
If not, see http://www.gnu.org/licenses.
*/
package fr.orsay.lri.varna.applications;
import java.awt.BorderLayout;
import java.awt.Color;
import java.awt.Component;
import java.awt.Dimension;
import java.awt.Font;
import java.awt.GridLayout;
import java.awt.datatransfer.DataFlavor;
import java.awt.datatransfer.Transferable;
import java.awt.dnd.DnDConstants;
import java.awt.dnd.DropTarget;
import java.awt.dnd.DropTargetDragEvent;
import java.awt.dnd.DropTargetDropEvent;
import java.awt.dnd.DropTargetEvent;
import java.awt.dnd.DropTargetListener;
import java.awt.event.ActionEvent;
import java.awt.event.ActionListener;
import java.awt.event.MouseEvent;
import java.awt.event.MouseListener;
import java.awt.geom.Point2D.Double;
import java.io.File;
import java.text.DateFormat;
import java.util.ArrayList;
import java.util.Collection;
import java.util.Date;
import java.util.Hashtable;
import java.util.List;
import java.util.Set;
import javax.swing.DefaultListModel;
import javax.swing.DefaultListSelectionModel;
import javax.swing.Icon;
import javax.swing.JButton;
import javax.swing.JFrame;
import javax.swing.JLabel;
import javax.swing.JList;
import javax.swing.JOptionPane;
import javax.swing.JPanel;
import javax.swing.JScrollPane;
import javax.swing.JSplitPane;
import javax.swing.JTextField;
import javax.swing.ListModel;
import javax.swing.ListSelectionModel;
import javax.swing.UIManager;
import javax.swing.UnsupportedLookAndFeelException;
import javax.swing.event.ListSelectionEvent;
import javax.swing.event.ListSelectionListener;
import javax.swing.text.BadLocationException;
import javax.swing.text.DefaultHighlighter;
import fr.orsay.lri.varna.VARNAPanel;
import fr.orsay.lri.varna.components.ReorderableJList;
import fr.orsay.lri.varna.exceptions.ExceptionFileFormatOrSyntax;
import fr.orsay.lri.varna.exceptions.ExceptionLoadingFailed;
import fr.orsay.lri.varna.exceptions.ExceptionNonEqualLength;
import fr.orsay.lri.varna.exceptions.ExceptionUnmatchedClosingParentheses;
import fr.orsay.lri.varna.factories.RNAFactory;
import fr.orsay.lri.varna.interfaces.InterfaceVARNAListener;
import fr.orsay.lri.varna.interfaces.InterfaceVARNARNAListener;
import fr.orsay.lri.varna.interfaces.InterfaceVARNASelectionListener;
import fr.orsay.lri.varna.models.BaseList;
import fr.orsay.lri.varna.models.FullBackup;
import fr.orsay.lri.varna.models.VARNAConfig;
import fr.orsay.lri.varna.models.rna.Mapping;
import fr.orsay.lri.varna.models.rna.ModeleBP;
import fr.orsay.lri.varna.models.rna.ModeleBase;
import fr.orsay.lri.varna.models.rna.RNA;
public class VARNAGUI extends JFrame implements DropTargetListener, InterfaceVARNAListener, MouseListener {
/**
*
*/
private static final long serialVersionUID = -790155708306987257L;
private static final String DEFAULT_SEQUENCE = "CAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIA";
private static final String DEFAULT_STRUCTURE1 = "..(((((...(((((...(((((...(((((.....)))))...))))).....(((((...(((((.....)))))...))))).....)))))...)))))..";
private static final String DEFAULT_STRUCTURE2 = "..(((((...(((((...(((((........(((((...(((((.....)))))...)))))..................))))).....)))))...)))))..";
// private static final String DEFAULT_STRUCTURE1 = "((((....))))";
// private static final String DEFAULT_STRUCTURE2 =
// "((((..(((....)))..))))";
private VARNAPanel _vp;
private JPanel _tools = new JPanel();
private JPanel _input = new JPanel();
private JPanel _seqPanel = new JPanel();
private JPanel _strPanel = new JPanel();
private JLabel _info = new JLabel();
private JTextField _str = new JTextField(DEFAULT_STRUCTURE1);
Object _hoverHighlightStr = null;
ArrayList<Object> _selectionHighlightStr = new ArrayList<Object>();
private JTextField _seq = new JTextField(DEFAULT_SEQUENCE);
Object _hoverHighlightSeq = null;
ArrayList<Object> _selectionHighlightSeq = new ArrayList<Object>();
private JLabel _strLabel = new JLabel(" Str:");
private JLabel _seqLabel = new JLabel(" Seq:");
private JButton _createButton = new JButton("Create");
private JButton _deleteButton = new JButton("Delete");
private JButton _duplicateButton = new JButton("Snapshot");
private JPanel _listPanel = new JPanel();
private ReorderableJList _sideList = null;
private static String errorOpt = "error";
@SuppressWarnings("unused")
private boolean _error;
private Color _backgroundColor = Color.white;
private static int _nextID = 1;
@SuppressWarnings("unused")
private int _algoCode;
private BackupHolder _rnaList;
public VARNAGUI() {
super("VARNA GUI");
RNAPanelDemoInit();
}
private void RNAPanelDemoInit()
{
DefaultListModel dlm = new DefaultListModel();
int marginTools = 40;
DefaultListSelectionModel m = new DefaultListSelectionModel();
m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION);
m.setLeadAnchorNotificationEnabled(false);
_sideList = new ReorderableJList();
_sideList.setModel(dlm);
_sideList.addMouseListener(this);
_sideList.setSelectionModel(m);
_sideList.setPreferredSize(new Dimension(100, 0));
_sideList.addListSelectionListener( new ListSelectionListener(){
public void valueChanged(ListSelectionEvent arg0) {
//System.out.println(arg0);
if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting())
{
FullBackup sel = (FullBackup) _sideList.getSelectedValue();
Mapping map = Mapping.DefaultOutermostMapping(_vp.getRNA().getSize(), sel.rna.getSize());
_vp.showRNAInterpolated(sel.rna,sel.config,map);
_seq.setText(sel.rna.getSeq());
_str.setText(sel.rna.getStructDBN(true));
}
}
});
_rnaList = new BackupHolder(dlm,_sideList);
RNA _RNA1 = new RNA("User defined 1");
RNA _RNA2 = new RNA("User defined 2");
try {
_vp = new VARNAPanel("0",".");
_RNA1.setRNA(DEFAULT_SEQUENCE, DEFAULT_STRUCTURE1);
_RNA1.drawRNARadiate(_vp.getConfig());
_RNA2.setRNA(DEFAULT_SEQUENCE, DEFAULT_STRUCTURE2);
_RNA2.drawRNARadiate(_vp.getConfig());
} catch (ExceptionNonEqualLength e) {
_vp.errorDialog(e);
} catch (ExceptionUnmatchedClosingParentheses e2) {
e2.printStackTrace();
} catch (ExceptionFileFormatOrSyntax e3) {
e3.printStackTrace();
}
_vp.setPreferredSize(new Dimension(400, 400));
_rnaList.add(_vp.getConfig().clone(),_RNA2,generateDefaultName());
_rnaList.add(_vp.getConfig().clone(),_RNA1,generateDefaultName(),true);
JScrollPane listScroller = new JScrollPane(_sideList);
listScroller.setPreferredSize(new Dimension(150, 0));
setBackground(_backgroundColor);
_vp.setBackground(_backgroundColor);
Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12");
_seqLabel.setHorizontalTextPosition(JLabel.LEFT);
_seqLabel.setPreferredSize(new Dimension(marginTools, 15));
_seq.setFont(textFieldsFont);
_seq.setText(DEFAULT_SEQUENCE);
_createButton.addActionListener(new ActionListener() {
public void actionPerformed(ActionEvent e) {
try {
RNA nRNA = new RNA(generateDefaultName());
nRNA.setRNA(_seq.getText(), _str.getText());
nRNA.drawRNARadiate(_vp.getConfig());
_rnaList.add(new VARNAConfig(),nRNA,true);
} catch (ExceptionUnmatchedClosingParentheses e1) {
JOptionPane.showMessageDialog(_vp, e1.getMessage(),"Error", JOptionPane.ERROR_MESSAGE);
} catch (ExceptionFileFormatOrSyntax e1) {
JOptionPane.showMessageDialog(_vp, e1.getMessage(),"Error", JOptionPane.ERROR_MESSAGE);
}
}
});
_seqPanel.setLayout(new BorderLayout());
_seqPanel.add(_seqLabel, BorderLayout.WEST);
_seqPanel.add(_seq, BorderLayout.CENTER);
_strLabel.setPreferredSize(new Dimension(marginTools, 15));
_strLabel.setHorizontalTextPosition(JLabel.LEFT);
_str.setFont(textFieldsFont);
_strPanel.setLayout(new BorderLayout());
_strPanel.add(_strLabel, BorderLayout.WEST);
_strPanel.add(_str, BorderLayout.CENTER);
_input.setLayout(new GridLayout(2, 0));
_input.add(_seqPanel);
_input.add(_strPanel);
JPanel goPanel = new JPanel();
goPanel.setLayout(new BorderLayout());
_tools.setLayout(new BorderLayout());
_tools.add(_input, BorderLayout.CENTER);
_tools.add(_info, BorderLayout.SOUTH);
_tools.add(goPanel, BorderLayout.EAST);
_deleteButton.addActionListener(new ActionListener() {
public void actionPerformed(ActionEvent e) {
_rnaList.removeSelected();
}
});
_duplicateButton.addActionListener(new ActionListener() {
public void actionPerformed(ActionEvent e) {
_rnaList.add((VARNAConfig)_vp.getConfig().clone(),_vp.getRNA().clone(),_vp.getRNA().getName()+"-"+DateFormat.getTimeInstance(DateFormat.LONG).format(new Date()),true);
}});
JPanel ops = new JPanel();
ops.setLayout(new GridLayout(1,2));
ops.add(_deleteButton);
ops.add(_duplicateButton);
JLabel j = new JLabel("Structures Manager",JLabel.CENTER);
_listPanel.setLayout(new BorderLayout());
_listPanel.add(ops,BorderLayout.SOUTH);
_listPanel.add(j,BorderLayout.NORTH);
_listPanel.add(listScroller,BorderLayout.CENTER);
goPanel.add(_createButton, BorderLayout.CENTER);
JSplitPane split = new JSplitPane(JSplitPane.HORIZONTAL_SPLIT,true,_listPanel,_vp);
getContentPane().setLayout(new BorderLayout());
getContentPane().add(split, BorderLayout.CENTER);
getContentPane().add(_tools, BorderLayout.NORTH);
setVisible(true);
DropTarget dt = new DropTarget(_vp, this);
_vp.addRNAListener(new InterfaceVARNARNAListener(){
public void onSequenceChanged(int index, String oldseq, String newseq) {
//System.out.println("Sequence changed: Index:"+index+" ["+oldseq+"]=>["+newseq+"]");
}
public void onStructureChanged(Set<ModeleBP> current,
Set<ModeleBP> addedBasePairs, Set<ModeleBP> removedBasePairs) {
String result = "";
//System.out.println("Structure changed: ");
for (ModeleBP s:addedBasePairs)
{ result +=s; }
//System.out.println(" Added: "+result);
result = "";
for (ModeleBP s:removedBasePairs)
{ result +=s; }
//System.out.println(" Removed: "+result);
}
public void onLayoutChanged(Hashtable<Integer, Double> previousPositions) {
//System.out.print("Layout changed, bases#: ");
String result = "";
for (Integer s:previousPositions.keySet())
{ result +=s+" "; }
//System.out.println(result);
}
});
_vp.addSelectionListener(new InterfaceVARNASelectionListener(){
public void onHoverChanged(ModeleBase oldbase, ModeleBase newBase) {
if (_hoverHighlightSeq!=null)
{
_seq.getHighlighter().removeHighlight(_hoverHighlightSeq);
_hoverHighlightSeq = null;
}
if (_hoverHighlightStr!=null)
{
_str.getHighlighter().removeHighlight(_hoverHighlightStr);
_hoverHighlightStr = null;
}
if (newBase!=null)
{
try {
_hoverHighlightSeq = _seq.getHighlighter().addHighlight(newBase.getIndex(), newBase.getIndex()+1, new DefaultHighlighter.DefaultHighlightPainter(Color.green) );
_hoverHighlightStr = _str.getHighlighter().addHighlight(newBase.getIndex(), newBase.getIndex()+1, new DefaultHighlighter.DefaultHighlightPainter(Color.green) );
} catch (BadLocationException e) {
e.printStackTrace();
}
}
}
public void onSelectionChanged(BaseList selection,
BaseList addedBases, BaseList removedBases) {
for(Object tag: _selectionHighlightSeq)
{
_seq.getHighlighter().removeHighlight(tag);
}
_selectionHighlightSeq.clear();
for(Object tag: _selectionHighlightStr)
{
_str.getHighlighter().removeHighlight(tag);
}
_selectionHighlightStr.clear();
for (ModeleBase m: selection.getBases())
{
try {
_selectionHighlightSeq.add(_seq.getHighlighter().addHighlight(m.getIndex(), m.getIndex()+1, new DefaultHighlighter.DefaultHighlightPainter(Color.orange) ));
_selectionHighlightStr.add(_str.getHighlighter().addHighlight(m.getIndex(), m.getIndex()+1, new DefaultHighlighter.DefaultHighlightPainter(Color.orange) ));
} catch (BadLocationException e) {
e.printStackTrace();
}
}
}
});
_vp.addVARNAListener(this);
}
public static String generateDefaultName()
{
return "User file #"+_nextID++;
}
public RNA getRNA() {
return (RNA)_sideList.getSelectedValue();
}
public String[][] getParameterInfo() {
String[][] info = {
// Parameter Name Kind of Value Description,
{ "sequenceDBN", "String", "A raw RNA sequence" },
{ "structureDBN", "String",
"An RNA structure in dot bracket notation (DBN)" },
{ errorOpt, "boolean", "To show errors" }, };
return info;
}
public void init() {
_vp.setBackground(_backgroundColor);
_error = true;
}
@SuppressWarnings("unused")
private Color getSafeColor(String col, Color def) {
Color result;
try {
result = Color.decode(col);
} catch (Exception e) {
try {
result = Color.getColor(col, def);
} catch (Exception e2) {
return def;
}
}
return result;
}
public VARNAPanel get_varnaPanel() {
return _vp;
}
public void set_varnaPanel(VARNAPanel surface) {
_vp = surface;
}
public JTextField get_seq() {
return _seq;
}
public void set_seq(JTextField _seq) {
this._seq = _seq;
}
public JLabel get_info() {
return _info;
}
public void set_info(JLabel _info) {
this._info = _info;
}
public static void main(String[] args) {
VARNAGUI d = new VARNAGUI();
d.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
d.pack();
d.setVisible(true);
}
public void dragEnter(DropTargetDragEvent arg0) {
// TODO Auto-generated method stub
}
public void dragExit(DropTargetEvent arg0) {
// TODO Auto-generated method stub
}
public void dragOver(DropTargetDragEvent arg0) {
// TODO Auto-generated method stub
}
public void drop(DropTargetDropEvent dtde) {
try {
Transferable tr = dtde.getTransferable();
DataFlavor[] flavors = tr.getTransferDataFlavors();
for (int i = 0; i < flavors.length; i++) {
if (flavors[i].isFlavorJavaFileListType()) {
dtde.acceptDrop(DnDConstants.ACTION_COPY_OR_MOVE);
Object ob = tr.getTransferData(flavors[i]);
if (ob instanceof List)
{
List list = (List) ob;
for (int j = 0; j < list.size(); j++) {
Object o = list.get(j);
if (dtde.getSource() instanceof DropTarget)
{
DropTarget dt = (DropTarget) dtde.getSource();
Component c = dt.getComponent();
if (c instanceof VARNAPanel)
{
String path = o.toString();
VARNAPanel vp = (VARNAPanel) c;
try{
FullBackup bck = VARNAPanel.importSession(path);
_rnaList.add(bck.config, bck.rna,bck.name,true);
}
catch (ExceptionLoadingFailed e3)
{
Collection<RNA> rnas = RNAFactory.loadSecStr(path);
if (rnas.isEmpty())
{
throw new ExceptionFileFormatOrSyntax("No RNA could be parsed from that source.");
}
int id = 1;
for(RNA r: rnas)
{
r.drawRNA(vp.getConfig());
String name = r.getName();
if (name.equals(""))
{
name = path.substring(path.lastIndexOf(File.separatorChar)+1);
}
if (rnas.size()>1)
{
name += " - Molecule# "+id++;
}
_rnaList.add(vp.getConfig().clone(),r,name,true);
}
}
}
}
}
}
// If we made it this far, everything worked.
dtde.dropComplete(true);
return;
}
}
// Hmm, the user must not have dropped a file list
dtde.rejectDrop();
} catch (Exception e) {
e.printStackTrace();
dtde.rejectDrop();
}
}
public void dropActionChanged(DropTargetDragEvent arg0) {
}
private class BackupHolder{
private DefaultListModel _rnaList;
private ArrayList<RNA> _rnas = new ArrayList<RNA>();
JList _l;
public BackupHolder(DefaultListModel rnaList, JList l)
{
_rnaList = rnaList;
_l = l;
}
public void add(VARNAConfig c, RNA r)
{
add(c, r, r.getName(),false);
}
public void add(VARNAConfig c, RNA r,boolean select)
{
add(c, r, r.getName(),select);
}
public void add(VARNAConfig c, RNA r, String name)
{
add(c, r, name,false);
}
public void add(VARNAConfig c, RNA r, String name, boolean select)
{
if (select){
_l.removeSelectionInterval(0, _rnaList.size());
}
if (name.equals(""))
{
name = generateDefaultName();
}
FullBackup bck = new FullBackup(c,r,name);
_rnas.add(0, r);
_rnaList.add(0,bck);
if (select){
_l.setSelectedIndex(0);
}
}
public void remove(int i)
{
_rnas.remove(i);
_rnaList.remove(i);
}
public DefaultListModel getModel()
{
return _rnaList;
}
public boolean contains(RNA r)
{
return _rnas.contains(r);
}
/*public int getSize()
{
return _rnaList.getSize();
}*/
public FullBackup getElementAt(int i)
{
return (FullBackup) _rnaList.getElementAt(i);
}
public void removeSelected()
{
int i = _l.getSelectedIndex();
if (i!=-1)
{
if (_rnaList.getSize()==1)
{
RNA r = new RNA();
try {
r.setRNA(" ", ".");
} catch (ExceptionUnmatchedClosingParentheses e1) {
} catch (ExceptionFileFormatOrSyntax e1) {
}
_vp.showRNA(r);
_vp.repaint();
}
else
{
int newi = i+1;
if (newi==_rnaList.getSize())
{
newi = _rnaList.getSize()-2;
}
FullBackup bck = (FullBackup) _rnaList.getElementAt(newi);
_l.setSelectedValue(bck,true);
}
_rnaList.remove(i);
}
}
}
public void onStructureRedrawn() {
// TODO Auto-generated method stub
}
public void onUINewStructure(VARNAConfig v, RNA r) {
_rnaList.add(v, r,"",true);
}
public void onWarningEmitted(String s) {
// TODO Auto-generated method stub
}
public void mouseClicked(MouseEvent e) {
if(e.getClickCount() == 2){
int index = _sideList.locationToIndex(e.getPoint());
ListModel dlm = _sideList.getModel();
FullBackup item = (FullBackup) dlm.getElementAt(index);;
_sideList.ensureIndexIsVisible(index);
Object newName = JOptionPane.showInputDialog(
this,
"Specify a new name for this RNA",
"Rename RNA",
JOptionPane.QUESTION_MESSAGE,
(Icon)null,
null,
item.toString());
if (newName!=null)
{
item.name = newName.toString();
this._sideList.repaint();
}
}
}
public void mouseEntered(MouseEvent arg0) {
// TODO Auto-generated method stub
}
public void mouseExited(MouseEvent arg0) {
// TODO Auto-generated method stub
}
public void mousePressed(MouseEvent arg0) {
// TODO Auto-generated method stub
}
public void mouseReleased(MouseEvent arg0) {
// TODO Auto-generated method stub
}
}